Week 13&14 Spinned Down Yoph Protein Before and After 12/06/13
Figure 15. Yoph protein prior to spin down in centrifuge.
Figure 14. Expressed pellet of Yoph in pNIC-Bsa4 vector stored in mini freezer with lysis buffer.
Yoph Day 2 12/06/13 Completed
Enzyme Assay-testing enzyme 12/06/13 Results
Figure 13. Sample H containing abs value of 1.647 at 410nm.
Figure 12. Sample G containg abs value of 1.662 at 410nm.
Figure 11. sample F containing abs value of .284 at 410nm.
Figure 10. Sample E containing abs value of .114 at 410nm.
Figure 9. Sample D containing abs value of .83 at 410nm.
Figure 8. Sample C containing abs value of .78 at 410nm.
Figure 7. Sample B containing an abs value at 410nm of .285 abs.
Figure 6. Sample A containing an abs value at 410nm of .074.
Figure 5. Ocean Optics Red Tide UV-VIS Spectrometer (Vernier) calibration of Yoph at 600 nm is .9 abs 30 minutes after being stored in 37C shaking incubator.
Figure 4. Ocean Optics Red Tide UV-VIS Spectrometer (Vernier) calibration of Yoph at 600 nm is .325abs 45 minutes after being stored in 37C shaking incubator.
Figure 3. Ocean Optics Red Tide UV-VIS Spectrometer (Vernier) calibration of Yoph at 600 nm is .110abs.
Started Protein Expression with Yoph Day 1 12/05/13 Completed
>BEC7Rev-pLIC-Rev 887 887 0 0.05 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNANGGGNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANCNNNNNNNNNNTCNN TCNNNNNNNCNNNCNNNNTNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAANNNNCNNNNNNNNNNGNNNNNNCNNNNNNNNCNNNNNNNNNNNNNNNCNNNN NNNNNNNNNNANNNNNNNNNNNNNNNNNNNTNNTTNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNANNNNNNNNNANNNNNNNNANNNNNNNNNNANCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNCNNNNNNNNNCTNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNGNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNTNCNNNNNNNNNNNGNNNNNNGNNNN NNNNNNNNNNNNNNNNNNNNNNCTNNNNNNNNNNNNNNNNANTNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNANNNC NNNNNNNNNNNNNNNNNNNNNNNNNGNTNNNNNNNACNCNNNNGNCNNATNNGNNNNNNNNNANNGTNNNNNNNNANANNNNNNNNNNNNNNCGNNNNNNCNNNNNNNACANTCCN NCGANTCNCNNNNNNCNNNNNNNNGCNNNNNCNNNNCNCNNGNCNGNNNNNNNNNNNNNNANACCNCNNNCCNNN
Figure 2. Best DNA sequencing results displayed in BEC2For, BEC6Rev, and BEC7Rev.
Analysis: The results from DNA core facility indicated that there was a problem with the protein samples, or For/Rev primers. The results are not conclusive that there was any sort of positive clone, and most of the DNA sequence consisted of "N's" which are essentially unidentifiable nucleotides.
Figure 1. Chart displaying DNA sequencing table results (97854) with Req# and seqid.
Week 11&12 Submitted for DNA Sequencing 11/22/13 Completed MiniPrep Results on Samples 1-8 11/15/13 Completed
Figure 10. Sample 1 selected from test tube A with a concentration of 24.0 ng/uL.
Figure 9. Sample 2 selected from test tube A with a concentration of 41.6 ng/uL.
Figure 8. Sample 3 selected from test tube A with a concentration of 26.9 ng/uL.
Figure 7. Sample 4 selected from test tube A with a concentration of 58.5 ng/uL.
Figure 6. Sample 5 selected from test tube B with a concentration of 46.4 ng/uL.
Figure 5. Sample 6 selected from test tube B with a concentration of 84.00 ng/uL.
Figure 4. Sample 7 selected from test tube B with a concentration of 55.7 ng/uL.
Figure 3. Sample 8 selected from test tube B with a concentration of 24.3 ng/uL.
Analysis: Based on the results from samples 1-4 from tube A and 5-8 from tube B, on average tube B produced higher levels of concentration. This could be because the 3-8 ratio was more successful than a 1-2 ratio. The best concentration came from sample 6 of tube B with a concentration of 84.00 ng/uL.
MiniPrep and Select Restriction Enzymes 11/12/13 (Tue) Completed
Spin Down Samples 11/11/13 (Mon) Completed
Master Plate 11/10/13 (Sun) Completed
Plates did not show growth when checked on (Sat) so they were checked on (Sun) 11/10/13 and showed growth. A master plate was created and stored for overnight incubation on 11/10/13.
Figure 2. Master plate from overnight incubation on (11/11/13), four colonies were selected from the plate containing Tube A concentrations of insert and vector, and four colonies were selected from the plate containing Tube B colonial growth.
Analysis: When selecting colonies from plates A and B, a small micro-pipette tip was used.
Annealing and Transformation 11/08/13 (Fri) Completed
Figure 1. 2 day cloning results of STP1 gene in pNIC-Bsa4 plasmid using DH5a cells (C2987 New England BioLab inc.) on Kan+Suc resistant agar plates.
Analysis Pre-Transformation: During the first round of cloning; Upper Left plate: In Tube A 2 ul of T-4 treated accepting vector with 4 ul of T-4 treated insert was added. Lower Left Plate: In tube B 3 ul of T-4 treated accepting vector with 8 ul of T-4 treated insert was added.
Using Brandy's PCR sample (30ng/uL) and Brandy's pNIC (70ng/uL); plates indicated with a heart.
During the second round of cloning; Upper Right Plate: In Tube A 2ul of T-4 treated accepting vector with 4 ul of T-4 treated insert was added. Lower Right Plate: In tube B 3ul of T-4 treated accepting vector with 7 ul of T-4 treated insert was added.
Using Caroline's PCR sample (170ng/uL) and Brandy's pNIC (70 ng/uL).
Analysis Post-Transformation:
Only tubes from the first round of cloning were successful in producing small colonies on the second day of incubation (11/10/13).
All 4 plates were incubated for 2 days, possible reasons for the second round of plates not working is that those Suc+Kan resistant plates belonged to another student who no longer needed them. It is possible that those plates were not actually Kan resistant and as a result the bacterial colonies were killed. The plates that produced colonies, in the first round of cloning, were created by mentors. The plates in the upper and lower left (figure 1) appear to have solid small colony growth and no contaminating colonies looked present. The master plate was created using these two plates and stored overnight in the incubator (11/10/13). The plates that did not grow were left in the incubator for one more day, just as a precautionary measure.
Cohesive End Generation 11/08/13 (Fri) Completed
Week 9&10
Next Steps: Cohesive tail priming ends of pNIC and PCR sample & continue virtual screening
Virtual Screening (10/30/13-11/1/13) To be continued..
Cut pNIC-Bsa4 with Bsa-HF gel image 10/25/13
Figure 5. Agar Gel results of pNIC-Bsa4 cut with Bsa-HF, lane 1 1kb ladder (5ul), lane 2 100bp ladder (5ul), lane 3 D'ondra's sample, lane 4 clear, lane 5 (my sample) with 10 uL PCR cleanup sample and 2uL blue juice.
Analysis: 100bp ladder was accidentally added. The STP1 gene is 739 bp, the regions where Bsa-HF cut are around the BsaI sites to remove SacB gene are accurate. Also the samples in lane 5 (my samples) are bright indicating there is a good amount of protein present. Image below indicates an NEB cut of the restriction enzyme Bsa-I sites of pNIC-Bsa4 at bp regions 5353 and 1931.
pNIC-Bsa4 clean-up Trial 2 10/25/13
Figure 4. Nanodrop report of pNIC-Bsa4 clean-up with final concentration of 69.9 ng/uL.
pNIC-Bsa4 clean-up Trial 1 10/25/13
Figure 3. Nanodrop report of pNIC-Bsa4 clean-up with final concentration of 71.0ng/uL.
Analysis: The pNIC pellet used during clean up was a dark brown, as opposed to the last pNIC clean up which was a light yellow. Color aids in indicating how much of the colony grew, and will be able to be purified to reach a better concentration. The final concentration of figures 3 and 4 range around 70 ng/uL. An ideal concentration would be 100+ ng/uL, however a concentration above 50 ng/uL can be worked with. The higher the concentration the better because pNIC is the vector that will be used to insert the STP1 gene, and remove SacB to allow the protein colonies to grow with the STP1 gene inserted.
PCR Clean-up Trial 2 10/24/13
Figure 2. Nanodrop report of PCR Clean-up with final concentration of 28.9ng/uL.
PCR Clean-up Trial 1 10/24/13
Figure 1. Nanodrop report of PCR clean-up with final concentration of 28.9ng/uL.
Analysis: During PCR clean up, not enough of the sample B was available to preform PCR clean-up. As a result what was left of sample B (30uL) was combined with sample A PCR tubes (150uL). Sample A bands were present during gel electrophoresis (seen in figure 4 image from week 7&8) however sample B was much brighter. The expected nano drop results were low, since sample A would dull the concentration of what sample B was originally. However, the results were much better than what had been predicted. Figures 1 and 2 indicate the final concentration around 29 ng/uL. Although this number is not good, it is not bad and will continue to be worked with in future cloning/transformation/expression steps.
Good. More data? -UM
Week 7&8
Next steps: PCR Clean-up and cut pNIC-Bsa4
pNIC-Midi Prep and Nanodrop Trial 2 10/18/13
Figure 6. First Nanodrop report after pNIC-Midi Prep with a concentration of 41.4 ng/uL.
Figure 5. First Nanodrop report after pNIC-Midi Prep with a concentration of 42.6 ng/uL.
Transformation Trial 2 10/17/13 Completed
PCR Squared Trial 5 10/17/13
Figure 4. Agar Gel results of PCR squared, lane 1 1kb ladder (5ul), lane 2 100bp ladder (5ul), lane 3 PCR sample A (10ul, 2ul blue juice),
lane 4 PCR sample A (10ul, 2ul blue juice), lane 5 PCR sample A (10ul, 2ul blue juice), lane 6 PCR sample A (10ul, 2ul blue juice), lane 7 PCR sample B (10ul, 2ul blue juice), lane 8 PCR sample B (10ul, 2ul blue juice), lane 9 PCR sample B (10ul, 2ul blue juice), lane 10 PCR sample B (10ul, 2ul blue juice).
Analysis: Gel ran at 120 AMP, .8 agarose used with 70ml of TAE buffer.
pNIC-Midi Prep and Nanodrop Trial 1 10/11/13
Figure 3. First Nanodrop report after pNIC-Midi Prep with a concentration of 19.6 ng/uL.
Figure 2. Second Nanodrop report after pNIC-Midi Prep with a concentration of 21.2 ng/uL.
Transformation Trial 1 10/11/13 Completed
PCR Squared Trial 4 10/10/13
Figure 1. Agar gel result of PCR squared, lane 3 containing 6ul of 100 bp ladder, lanes 4-8 containing 15ul of sample and 3ul of blue juice.
Analysis:
Gel AMP ran at 115, .8 agarose gel used with 70ml of nanopure.
Good job with the analysis and images. I'm liking the progress! Be sure to label wells individually in captions. Keep it up! - Michael T. 100713
Week 5 & 6
New Master Mix/PCR run to prepare for PCR Squared Trial 4 10/05/13 Completed
Transformation of competent cells for plasmid prep of pNIC-Bsa4 10/05/13 Completed
PCR Squared Trial 3 10/04/13
Figure 4. Agar gel result of PCR squared, lane 3 containing 7ul of 100bp ladder, lanes 4-7 containing 10ul (2ul blue juice) of sample.
Analysis: Gel was ran for 30 minutes on AMP 105. The agarose mix that was used was .8 agarose, 70ml nanopure water, and .5ul EthBr. When the gel began to bend slightly the image of the gel was taken, afterwards the samples were not visible via camera once past the halfway point of the gel. Reasons for the lack of band intensity could be a lack of DNA protein. Next steps are to make a new mixture from secondary PCR and try PCR squared again.
PCR Squared Trial 2 10/03/13
Figure 3. Agar gel result of PCR squared, lane 2 containing 5ul of 100bp ladder, lanes 3-6 containing 10ul (2ul blue juice) of sample.
Analysis:
Gel was ran for 40 minutes on AMP 110. When gel appeared to be curving slightly AMP was lowered to 100. This time .8 agarose and 75 nano pure water was used to make the gel mix. While the ladder did not appear clearly, there is a chance that this data is accurate since all of the samples are located in the same region. Also note that the ladder is brighter right above the samples, this could be the 1000 bp mark that has appeared to be dispersed in the gel. Lane 5 sample appears smaller, but was also noted that less sample seemed to be administered into this lane, explaining why the sample appears smaller. Other reasons for the samples to appear to be "smiling" could be if the TAE buffer was not accurately mixed, or if it is incorrectly labeled.
LB agar Plates/Broth Completed 09/27/13
PCR Squared Trial 1 09/27/13
Figure 2. Agar gel result of PCR squared, no samples visible in lanes.
Analysis:
The gel split during the run, and later on became wavy and distorted. Samples were most likely lost in the process. Reasons for the gel breaking could be from too much AMP or not enough agarose in the agar gel mixture. The agarose helps to stabilize the gel, if there was not enough then when heat was applied the gel likely became weak and broke. AMP for this gel was ran on 110.
Secondary PCR 09/26/13
Figure 1. Agar gel result of secondary PCR, lane 1 containing 100bp ladder, lane 2 containing other students sample, lane 3 containing secondary PCR sample (10ul sample 2ul blue juice).
Analysis:
Sample appeared to be "smiling" this could be due to the fact that the gel was cut in half along lane 3. Because of this, or excess heat, the sample could have become slightly distorted. Either way, the sample is in the correct location (738 bp) of the gene!
Primer Dilution Completed 09/26/13
Week 3 & 4
Brandy - good job, but crop your gel images. Crop them in the imaging software. Also need a Primary PCR gel here -- Dr. B 092513
(092713 - NOTE Dr. B corrected that Primary was there) Tail Primer Design (09/12/13)
On Google Drive Student Folder: https://drive.google.com/?tab=wo&authuser=0#folders/0B4O2KqKh2q_-VUNVTnM0UC1SYVU
Section of expression vector pNIC28-Bsa3 sequence:
Table 1. Melting temperature of forward primer at different Mg2+ concentrations
Reverse Primer: 5’TTG AAT CTG AAG CTG TTT AAC AGT AAA GGT GGA TA 3’ bp 35 GC Content 34.3%
0mM Mg 2+ Tm
1.5 mM Mg2+ Tm
2.0 mM Mg2+ Tm
4.0 mM Mg2+ Tm
6.0 mM Mg2+ Tm
59.7 C
67.8 C
68.3 C
69.4 C
69.9 C
Table 2. Melting temperature of reverse primer at different Mg2+ concentrations
RE Digest (09/13/13)
Figure 1. Photo of RE digest, lane 1 containing ladder 1kb marker, lane 2 containing protein pGBR22 (48.95 ng/uL), lane 3 containing PuvII enzyme, lane 4 containing enzyme BsaI, lane 5 containing both enzymes PvuII and BsaI.
Analysis: The enzymes PvuII and BsaI were used in this RE digest to cut the plasmid at specific sites. The enzyme BsaI was used instead of the enzyme that was supposed to be used, EcoRI . The incorrect enzyme still cut the plasmid. Lane 5, however, only shows two bands. This may be because the incorrect enzyme cut in a similar place as the other enzyme used, thus only two bands appear when there may be three in lane 5.
Figure 2. Results of NEBcutter with enzymes PvuII and BsaI.
Farther Analysis:
Results from NEBcutter indicated that there were two cuts in close proximity around 1000 bp. This represents the lower bar in lane 5.
The upper bar in lane 5 of Figure 1 is a cut from enzyme PvuII. Finially, the cut that did not appear in the gel was at the 100 bp region. This is likely because of the resolution of the gel. Therefore although BsaI was used instead of EcoRI, the enzyme still cut in the proper locations and the two bars displayed are in the correct bp regions! :)
PCR Take 2 (09/13/13)
Figure 3. Photo of PCR, lane 6 containing ladder 100bp marker, Sample A (0.3 ng/ml pGBR22) in lane 7, Sample B (3.0 ng/ml pGBR22) in lane 8, Sample C (30 ng/ml pGBR22) in lane 9, Sample D (0.0 pGBR22) in lane 10.
Analysis: The results of PCR indicate that there was an error in lanes 7-9. The protein pGBR22 did not appear in the lanes. This could be due to human error, environmental contamination, or the possibility that the reaction did not occur while in the PCR machine. (Note: I worked continuously with another student, our samples were in the same PCR machine, her bands appeared clearly and mine did not.)
Primary PCR (09/20/13)
Figure 4. Two images of the results of Primary PCR, 100bp ladder in lane 2, Primary PCR (1uM oligo mix) smear also represented in lane 3.
Analysis: The results of Primary PCR indicate that the gene sequence is between 500-1000bp. This is a good result because the length of the gene is 738bp. Next step is to start secondary PCR to further analyze the length of the gene.
Thermocycler cycling conditions used for Primary PCR:
98 C --> 30 seconds
98 C --> 7 seconds (20 cycles)
58 C --> 20 seconds (20..)
72 C --> 25 seconds (20 cont.)
72 C --> 2 min
4 C --> Infinite
(Note: In PCR Materials 5 ul of 2 mM dNTP was diluted, 1ul dNTP to 4 ul nano)
9/20/13 (Primers Arrived!)
Figure 5. Image of Primer Sa_STP1 Forward information that arrived 09/20/13.
Figure 6. Image of Primer Sa_STP1 Reverse information that arrived 09/20/13.
Week 1 & 2
Brandy, good job, good commentary. So, re-do PCR this week. - Dr. B 090913
NanoDrop (09/02/13)
In this lab a spectrometer was used to identify the concentration and absorption of protein pGBR-22.
Figure 1. Run 1 Elution Graph, wavelength (nm) vs. absorbance (mm), results of pGBR22 protein (156.8 ng/ul) with a concentration of 165.4 ng/uL.
Figure 2. Run 2 Elution Graph, wavelength (nm) vs. absorbance (mm), results of pGBR22 protein (156.8 ng/ul) with a concentration of 150.5.
Conclusion: The use of the nano drop spectrometer allowed for the purity of the pGBR22 protein sample to be determined based on the absorbance and concentration results. Run 1 indicated a concentration of 165.5 ng/uL, while run 2 indicated a concentration of 150.5 ng/uL. These concentrations were slightly different, this is most likely a result of extra pGBR22, nano drop or buffer residue.
Submit to DNA Sequencing (09/02/13)
PCR & Run on Agarose Gel (09/02/13-09/05/13)
The purpose of this experiment was to test samples of different plasmid dilutions.
Figure 1. Agarose Gel of alternative dilutions of pGBR22 samples. Lane 1 contains 5 ul of Ladder solution, Lane 2-4 represent different dilutions of plasmid sample, Lane 5 represents a controlled sample with zero plasmid.
Conclusion: The results of the aragose gel are poor and only lane one is slightly visible. The errors of the gel results could be because of the smear obstructing the view of the solutions, contamination from unknown particles, or lack of keeping the samples cool between experimental steps.
DNA Analysis (09/05/13)
.>Untitled reverse complementTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTATTTAGGTGACACTATAGAATACTCAAGCTATGCATCCAACGCGTTGGGAGCTCTCCCATATGGTCGACCTGCAGGCGGCCGCACTAGTGATTTTGATTGATTGAAGGAGAAATATCATGAGTGTGATCGCTAAACAAATGACCTACAAGGTTTATATGTCAGGCACGGTCAATGGACACTACTTTGAGGTCGAAGGCGATGGAAAAGGAAAGCCTTACGAGGGGGAGCAGACGGTAAAGCTCACTGTCACCAAGGGTGGACCTCTGCCATTTGCTTGGGATATTTTATCACCACTGTCTCAATACGGAAGCATACCATTCACCAAGTACCCTGAAGACATCCCTGATTATGTAAAGCAGTCATTCCCTGAGGGATATACATGGGAGAGGATCATGAACTTTGAAGATGGTGCAGTGTGTACTGTCAGCAATGATTCCAGCATCCAAGGCAACTGTTTCATCTACAATGTCAAAATCTCTGGTGTGAACTTTCCTCCCAATGGACCTGTTATGCAGAAGAAGACACAGGGCTGGGAACCCAACACTGAGCGTCTCTTTGCACGAGATGGAATGCTGATAGGAAACAACTTTATGGCTCTGAAGTTGGAAGGAGGTGGTTACTATTTGTGTGAATTCAAATCTACTTACAAGGCAAAGAAGCCTGTGAGGATGCCAGGGTATCACTATGTTGACCGCAAACTGGATGTAACCAGTCACAACAAGGATTACACATTTGTTGAGCAGTGTGAAATATCCATTGCACGCCACTCTTTGCTCGGTCATCACCATCACCATCACTAAAATCCCGCGGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCC
The purpose of this experiment was to analyze a sequence of DNA from pGBR22 protein.
Week 13&14
Spinned Down Yoph Protein Before and After 12/06/13
Figure 15. Yoph protein prior to spin down in centrifuge.
Figure 14. Expressed pellet of Yoph in pNIC-Bsa4 vector stored in mini freezer with lysis buffer.
Yoph Day 2 12/06/13 Completed
Enzyme Assay-testing enzyme 12/06/13 Results
Figure 13. Sample H containing abs value of 1.647 at 410nm.
Figure 12. Sample G containg abs value of 1.662 at 410nm.
Figure 11. sample F containing abs value of .284 at 410nm.
Figure 10. Sample E containing abs value of .114 at 410nm.
Figure 9. Sample D containing abs value of .83 at 410nm.
Figure 8. Sample C containing abs value of .78 at 410nm.
Figure 7. Sample B containing an abs value at 410nm of .285 abs.
Figure 6. Sample A containing an abs value at 410nm of .074.
Figure 5. Ocean Optics Red Tide UV-VIS Spectrometer (Vernier) calibration of Yoph at 600 nm is .9 abs 30 minutes after being stored in 37C shaking incubator.
Figure 4. Ocean Optics Red Tide UV-VIS Spectrometer (Vernier) calibration of Yoph at 600 nm is .325abs 45 minutes after being stored in 37C shaking incubator.
Figure 3. Ocean Optics Red Tide UV-VIS Spectrometer (Vernier) calibration of Yoph at 600 nm is .110abs.
Started Protein Expression with Yoph Day 1 12/05/13 Completed
Sequencing Results 11/26/13 Completed
>BEC2For-pLIC-For 144 144 0 0.05
NNNNNNNNNNNNNNNNNNNNNNNAGNNNNNNNNNNNNNNNNNGGGGNTNNNNNNNNNNNNNNNNCNNNNNNNNNNNNCNNNNNNNNNNNNNNNCNCNNNNNCNNNNNNNNCNCCN NNNGNCCNNNNNNNNNNNNNNCCNCNNNN
>BEC6Rev-pLIC-Rev 435 435 0 0.05
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNTNNNNGNNNTNCNNNNNNNNTNNNNNNNGGCNNNNGNNCNTNTNAANCNNNNCNNTNANCANNACANNNNCNNCNNN GANNTNNNNNNNAAGNNNNNNNNNNNNNNNAAGANNNNNNTNNNANGNTNNTNCNNANANNNNNNNCNAGNGNNNNNCNNGGNGCNNNNNNGNNNNNNNNNNNNNNNNNNANNNN ANNNNNGANGNNNNNNNNNCTNNCNNNNCGGNNNNNNNGNNCCNCNNNNNNNNCGNNNNNNNNNNNNGGNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNCNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNN
>BEC7Rev-pLIC-Rev 887 887 0 0.05
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNANGGGNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANCNNNNNNNNNNTCNN TCNNNNNNNCNNNCNNNNTNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAANNNNCNNNNNNNNNNGNNNNNNCNNNNNNNNCNNNNNNNNNNNNNNNCNNNN NNNNNNNNNNANNNNNNNNNNNNNNNNNNNTNNTTNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNANNNNNNNNNANNNNNNNNANNNNNNNNNNANCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNCNNNNNNNNNCTNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNGNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNTNCNNNNNNNNNNNGNNNNNNGNNNN NNNNNNNNNNNNNNNNNNNNNNCTNNNNNNNNNNNNNNNNANTNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNANNNC NNNNNNNNNNNNNNNNNNNNNNNNNGNTNNNNNNNACNCNNNNGNCNNATNNGNNNNNNNNNANNGTNNNNNNNNANANNNNNNNNNNNNNNCGNNNNNNCNNNNNNNACANTCCN NCGANTCNCNNNNNNCNNNNNNNNGCNNNNNCNNNNCNCNNGNCNGNNNNNNNNNNNNNNANACCNCNNNCCNNN
Figure 2. Best DNA sequencing results displayed in BEC2For, BEC6Rev, and BEC7Rev.
Analysis: The results from DNA core facility indicated that there was a problem with the protein samples, or For/Rev primers. The results are not conclusive that there was any sort of positive clone, and most of the DNA sequence consisted of "N's" which are essentially unidentifiable nucleotides.
Figure 1. Chart displaying DNA sequencing table results (97854) with Req# and seqid.
Week 11&12
Submitted for DNA Sequencing 11/22/13 Completed
MiniPrep Results on Samples 1-8 11/15/13 Completed
Figure 10. Sample 1 selected from test tube A with a concentration of 24.0 ng/uL.
Figure 9. Sample 2 selected from test tube A with a concentration of 41.6 ng/uL.
Figure 8. Sample 3 selected from test tube A with a concentration of 26.9 ng/uL.
Figure 7. Sample 4 selected from test tube A with a concentration of 58.5 ng/uL.
Figure 6. Sample 5 selected from test tube B with a concentration of 46.4 ng/uL.
Figure 5. Sample 6 selected from test tube B with a concentration of 84.00 ng/uL.
Figure 4. Sample 7 selected from test tube B with a concentration of 55.7 ng/uL.
Figure 3. Sample 8 selected from test tube B with a concentration of 24.3 ng/uL.
Analysis: Based on the results from samples 1-4 from tube A and 5-8 from tube B, on average tube B produced higher levels of concentration. This could be because the 3-8 ratio was more successful than a 1-2 ratio. The best concentration came from sample 6 of tube B with a concentration of 84.00 ng/uL.
MiniPrep and Select Restriction Enzymes 11/12/13 (Tue) Completed
Spin Down Samples 11/11/13 (Mon) Completed
Master Plate 11/10/13 (Sun) Completed
Plates did not show growth when checked on (Sat) so they were checked on (Sun) 11/10/13 and showed growth. A master plate was created and stored for overnight incubation on 11/10/13.
Figure 2. Master plate from overnight incubation on (11/11/13), four colonies were selected from the plate containing Tube A concentrations of insert and vector, and four colonies were selected from the plate containing Tube B colonial growth.
Analysis: When selecting colonies from plates A and B, a small micro-pipette tip was used.
Annealing and Transformation 11/08/13 (Fri) Completed
Figure 1. 2 day cloning results of STP1 gene in pNIC-Bsa4 plasmid using DH5a cells (C2987 New England BioLab inc.) on Kan+Suc resistant agar plates.
Analysis Pre-Transformation:
During the first round of cloning;
Upper Left plate: In Tube A 2 ul of T-4 treated accepting vector with 4 ul of T-4 treated insert was added.
Lower Left Plate: In tube B 3 ul of T-4 treated accepting vector with 8 ul of T-4 treated insert was added.
Using Brandy's PCR sample (30ng/uL) and Brandy's pNIC (70ng/uL); plates indicated with a heart.
During the second round of cloning;
Upper Right Plate: In Tube A 2ul of T-4 treated accepting vector with 4 ul of T-4 treated insert was added.
Lower Right Plate: In tube B 3ul of T-4 treated accepting vector with 7 ul of T-4 treated insert was added.
Using Caroline's PCR sample (170ng/uL) and Brandy's pNIC (70 ng/uL).
Analysis Post-Transformation:
Only tubes from the first round of cloning were successful in producing small colonies on the second day of incubation (11/10/13).
All 4 plates were incubated for 2 days, possible reasons for the second round of plates not working is that those Suc+Kan resistant plates belonged to another student who no longer needed them. It is possible that those plates were not actually Kan resistant and as a result the bacterial colonies were killed. The plates that produced colonies, in the first round of cloning, were created by mentors. The plates in the upper and lower left (figure 1) appear to have solid small colony growth and no contaminating colonies looked present. The master plate was created using these two plates and stored overnight in the incubator (11/10/13). The plates that did not grow were left in the incubator for one more day, just as a precautionary measure.
Cohesive End Generation 11/08/13 (Fri) Completed
Week 9&10
Next Steps: Cohesive tail priming ends of pNIC and PCR sample & continue virtual screening
Virtual Screening (10/30/13-11/1/13) To be continued..
Cut pNIC-Bsa4 with Bsa-HF gel image 10/25/13
Figure 5. Agar Gel results of pNIC-Bsa4 cut with Bsa-HF, lane 1 1kb ladder (5ul), lane 2 100bp ladder (5ul), lane 3 D'ondra's sample, lane 4 clear, lane 5 (my sample) with 10 uL PCR cleanup sample and 2uL blue juice.
Analysis: 100bp ladder was accidentally added. The STP1 gene is 739 bp, the regions where Bsa-HF cut are around the BsaI sites to remove SacB gene are accurate. Also the samples in lane 5 (my samples) are bright indicating there is a good amount of protein present. Image below indicates an NEB cut of the restriction enzyme Bsa-I sites of pNIC-Bsa4 at bp regions 5353 and 1931.
pNIC-Bsa4 clean-up Trial 2 10/25/13
Figure 4. Nanodrop report of pNIC-Bsa4 clean-up with final concentration of 69.9 ng/uL.
pNIC-Bsa4 clean-up Trial 1 10/25/13
Figure 3. Nanodrop report of pNIC-Bsa4 clean-up with final concentration of 71.0ng/uL.
Analysis: The pNIC pellet used during clean up was a dark brown, as opposed to the last pNIC clean up which was a light yellow. Color aids in indicating how much of the colony grew, and will be able to be purified to reach a better concentration. The final concentration of figures 3 and 4 range around 70 ng/uL. An ideal concentration would be 100+ ng/uL, however a concentration above 50 ng/uL can be worked with. The higher the concentration the better because pNIC is the vector that will be used to insert the STP1 gene, and remove SacB to allow the protein colonies to grow with the STP1 gene inserted.
PCR Clean-up Trial 2 10/24/13
Figure 2. Nanodrop report of PCR Clean-up with final concentration of 28.9ng/uL.
PCR Clean-up Trial 1 10/24/13
Figure 1. Nanodrop report of PCR clean-up with final concentration of 28.9ng/uL.
Analysis: During PCR clean up, not enough of the sample B was available to preform PCR clean-up. As a result what was left of sample B (30uL) was combined with sample A PCR tubes (150uL). Sample A bands were present during gel electrophoresis (seen in figure 4 image from week 7&8) however sample B was much brighter. The expected nano drop results were low, since sample A would dull the concentration of what sample B was originally. However, the results were much better than what had been predicted. Figures 1 and 2 indicate the final concentration around 29 ng/uL. Although this number is not good, it is not bad and will continue to be worked with in future cloning/transformation/expression steps.
Good. More data? -UM
Week 7&8
Next steps: PCR Clean-up and cut pNIC-Bsa4
pNIC-Midi Prep and Nanodrop Trial 2 10/18/13
Figure 6. First Nanodrop report after pNIC-Midi Prep with a concentration of 41.4 ng/uL.
Figure 5. First Nanodrop report after pNIC-Midi Prep with a concentration of 42.6 ng/uL.
Transformation Trial 2 10/17/13 Completed
PCR Squared Trial 5 10/17/13
Figure 4. Agar Gel results of PCR squared, lane 1 1kb ladder (5ul), lane 2 100bp ladder (5ul), lane 3 PCR sample A (10ul, 2ul blue juice),
lane 4 PCR sample A (10ul, 2ul blue juice), lane 5 PCR sample A (10ul, 2ul blue juice), lane 6 PCR sample A (10ul, 2ul blue juice), lane 7 PCR sample B (10ul, 2ul blue juice), lane 8 PCR sample B (10ul, 2ul blue juice), lane 9 PCR sample B (10ul, 2ul blue juice), lane 10 PCR sample B (10ul, 2ul blue juice).
Analysis: Gel ran at 120 AMP, .8 agarose used with 70ml of TAE buffer.
pNIC-Midi Prep and Nanodrop Trial 1 10/11/13
Figure 3. First Nanodrop report after pNIC-Midi Prep with a concentration of 19.6 ng/uL.
Figure 2. Second Nanodrop report after pNIC-Midi Prep with a concentration of 21.2 ng/uL.
Transformation Trial 1 10/11/13 Completed
PCR Squared Trial 4 10/10/13
Figure 1. Agar gel result of PCR squared, lane 3 containing 6ul of 100 bp ladder, lanes 4-8 containing 15ul of sample and 3ul of blue juice.
Analysis:
Gel AMP ran at 115, .8 agarose gel used with 70ml of nanopure.
Good job with the analysis and images. I'm liking the progress! Be sure to label wells individually in captions. Keep it up! - Michael T. 100713
Week 5 & 6
New Master Mix/PCR run to prepare for PCR Squared Trial 4 10/05/13 Completed
Transformation of competent cells for plasmid prep of pNIC-Bsa4 10/05/13 Completed
PCR Squared Trial 3 10/04/13
Figure 4. Agar gel result of PCR squared, lane 3 containing 7ul of 100bp ladder, lanes 4-7 containing 10ul (2ul blue juice) of sample.
Analysis:
Gel was ran for 30 minutes on AMP 105. The agarose mix that was used was .8 agarose, 70ml nanopure water, and .5ul EthBr. When the gel began to bend slightly the image of the gel was taken, afterwards the samples were not visible via camera once past the halfway point of the gel. Reasons for the lack of band intensity could be a lack of DNA protein. Next steps are to make a new mixture from secondary PCR and try PCR squared again.
PCR Squared Trial 2 10/03/13
Figure 3. Agar gel result of PCR squared, lane 2 containing 5ul of 100bp ladder, lanes 3-6 containing 10ul (2ul blue juice) of sample.
Analysis:
Gel was ran for 40 minutes on AMP 110. When gel appeared to be curving slightly AMP was lowered to 100. This time .8 agarose and 75 nano pure water was used to make the gel mix. While the ladder did not appear clearly, there is a chance that this data is accurate since all of the samples are located in the same region. Also note that the ladder is brighter right above the samples, this could be the 1000 bp mark that has appeared to be dispersed in the gel. Lane 5 sample appears smaller, but was also noted that less sample seemed to be administered into this lane, explaining why the sample appears smaller. Other reasons for the samples to appear to be "smiling" could be if the TAE buffer was not accurately mixed, or if it is incorrectly labeled.
LB agar Plates/Broth Completed 09/27/13
PCR Squared Trial 1 09/27/13
Figure 2. Agar gel result of PCR squared, no samples visible in lanes.
Analysis:
The gel split during the run, and later on became wavy and distorted. Samples were most likely lost in the process. Reasons for the gel breaking could be from too much AMP or not enough agarose in the agar gel mixture. The agarose helps to stabilize the gel, if there was not enough then when heat was applied the gel likely became weak and broke. AMP for this gel was ran on 110.
Secondary PCR 09/26/13
Figure 1. Agar gel result of secondary PCR, lane 1 containing 100bp ladder, lane 2 containing other students sample, lane 3 containing secondary PCR sample (10ul sample 2ul blue juice).
Analysis:
Sample appeared to be "smiling" this could be due to the fact that the gel was cut in half along lane 3. Because of this, or excess heat, the sample could have become slightly distorted. Either way, the sample is in the correct location (738 bp) of the gene!
Primer Dilution Completed 09/26/13
Week 3 & 4
Brandy - good job, but crop your gel images. Crop them in the imaging software. Also need a Primary PCR gel here -- Dr. B 092513
(092713 - NOTE Dr. B corrected that Primary was there)
Tail Primer Design (09/12/13)
On Google Drive Student Folder: https://drive.google.com/?tab=wo&authuser=0#folders/0B4O2KqKh2q_-VUNVTnM0UC1SYVU
Section of expression vector pNIC28-Bsa3 sequence:
TCTCTCCTGACTGACATCGGTCAACGTCGCTCTAATAACCAGGACTTCATCAATCAGTTCGAAAACAAGGCC
GGTGTTCCGCTCATCATCCTGGCGGACGGCATGGGCGGTCACCGTGCGGGTAACATTGCGAGCGAAATGA
CCGTTACCGATCTGGGCTCTGACTGGGCGGAAACCGACTTCTCTGAACTGTCTGAAATCCGTGACTGGATGC
TCGTTTCTATCGAAACGGAAAACCGTAAAATCTACGAACTGGGTCAGTCTGACGACTACATACTTCCAATCCTA
CTTCCAATCCAAGGTATGGGTACCACCATCGAAGCGGTTGCGATCGTTGGCGACAACATCATCTTCGCGCACGT
TGGTGACTCTCGTATCGGTATCGTTCGTCAGGGTGAATACCATCTGCTGACTTCCGACCACTCTCTGGTTAACGA
GCTGGTGAAAGCGGGTCAACTGACCGAAGAAGAAGCGGCGTCTCACCCGCAGAAGAATATCATCACCCAGTCTA
TTGGCCAGGCGAACCCGGTTGAACCGGACCTGGGCGTCCACCTGCTGGAAGAAGGTGACTACCTGGTTGTTAA
CTCTGACGGTCTGACCAACATGCTGTCTAACGCGGACATCGCGACCGTTCTGACGCAGGAAAAAACCCTGGAC
GACAAAAATCAGGACCTGATCACTCTCGCTAACCATCGTGGTGGTCTGGACAATATTACCGTTGCGCTGGTATA
CGTTGAATCTGAAGCTGTTTAACAGTAAAGGTGGATACGGATCCGAAT
Forward Primer: 5’ TAC TTC CAA TCC ATG GAA ATC TCT CTC CTG ACT 3’
bp 33
GC Content 42.4%
Reverse Primer: 5’TTG AAT CTG AAG CTG TTT AAC AGT AAA GGT GGA TA 3’
bp 35
GC Content 34.3%
RE Digest (09/13/13)
Figure 1. Photo of RE digest, lane 1 containing ladder 1kb marker, lane 2 containing protein pGBR22 (48.95 ng/uL), lane 3 containing PuvII enzyme, lane 4 containing enzyme BsaI, lane 5 containing both enzymes PvuII and BsaI.
Analysis: The enzymes PvuII and BsaI were used in this RE digest to cut the plasmid at specific sites. The enzyme BsaI was used instead of the enzyme that was supposed to be used, EcoRI . The incorrect enzyme still cut the plasmid. Lane 5, however, only shows two bands. This may be because the incorrect enzyme cut in a similar place as the other enzyme used, thus only two bands appear when there may be three in lane 5.
Figure 2. Results of NEBcutter with enzymes PvuII and BsaI.
Farther Analysis:
Results from NEBcutter indicated that there were two cuts in close proximity around 1000 bp. This represents the lower bar in lane 5.
The upper bar in lane 5 of Figure 1 is a cut from enzyme PvuII. Finially, the cut that did not appear in the gel was at the 100 bp region. This is likely because of the resolution of the gel. Therefore although BsaI was used instead of EcoRI, the enzyme still cut in the proper locations and the two bars displayed are in the correct bp regions! :)
PCR Take 2 (09/13/13)
Figure 3. Photo of PCR, lane 6 containing ladder 100bp marker, Sample A (0.3 ng/ml pGBR22) in lane 7, Sample B (3.0 ng/ml pGBR22) in lane 8, Sample C (30 ng/ml pGBR22) in lane 9, Sample D (0.0 pGBR22) in lane 10.
Analysis: The results of PCR indicate that there was an error in lanes 7-9. The protein pGBR22 did not appear in the lanes. This could be due to human error, environmental contamination, or the possibility that the reaction did not occur while in the PCR machine. (Note: I worked continuously with another student, our samples were in the same PCR machine, her bands appeared clearly and mine did not.)
Primary PCR (09/20/13)
Figure 4. Two images of the results of Primary PCR, 100bp ladder in lane 2, Primary PCR (1uM oligo mix) smear also represented in lane 3.
Analysis: The results of Primary PCR indicate that the gene sequence is between 500-1000bp. This is a good result because the length of the gene is 738bp. Next step is to start secondary PCR to further analyze the length of the gene.
Thermocycler cycling conditions used for Primary PCR:
98 C --> 30 seconds
98 C --> 7 seconds (20 cycles)
58 C --> 20 seconds (20..)
72 C --> 25 seconds (20 cont.)
72 C --> 2 min
4 C --> Infinite
(Note: In PCR Materials 5 ul of 2 mM dNTP was diluted, 1ul dNTP to 4 ul nano)
9/20/13 (Primers Arrived!)
Figure 5. Image of Primer Sa_STP1 Forward information that arrived 09/20/13.
Figure 6. Image of Primer Sa_STP1 Reverse information that arrived 09/20/13.
Week 1 & 2
Brandy, good job, good commentary. So, re-do PCR this week. - Dr. B 090913
Oligotide Primer Design (09/02/13)
Modified DNA sequence:
1 ATGGAGATTTCTCTCCTGACCGACATCGGTCAACGTCGTAGCAACAATCAAGACTTCATC
61 AACCAGTTTGAGAACAAAGCGGGCGTTCCACTGATCATCCTGGCGGACGGTATGGGTGGT
121 CACCGTGCGGGTAATATCGCGTCTGAAATGACCGTTACCGATCTGGGTAGCGACTGGGCG
181 GAAACTGACTTCTCTGAACTGTCTGAGATCCGTGACTGGATGCTGGTTTCTATCGAAACC
241 GAAAACCGTAAAATCTACGAACTGGGCCAGTCTGACGACTACAAAGGCATGGGTACCACC
301 ATCGAAGCGGTTGCGATCGTTGGTGACAACATTATCTTCGCGCACGTAGGTGACTCTCGT
361 ATCGGTATCGTTCGTCAAGGTGAGTACCATCTGCTGACCAGCGATCACTCTCTGGTTAAC
421 GAACTCGTTAAGGCGGGTCAGCTCACGGAGGAGGAAGCGGCGTCTCACCCGCAGAAAAAC
481 ATCATCACCCAGTCTATTGGTCAAGCGAATCCGGTTGAACCGGACCTGGGTGTACATCTC
541 CTGGAAGAAGGCGACTACCTGGTTGTTAACTCTGACGGTCTGACCAACATGCTGTCTAAC
601 GCGGACATCGCGACCGTTCTGACGCAGGAAAAAACCCTGGACGACAAAAACCAGGATCTG
661 ATCACCCTGGCGAACCACCGTGGCGGCCTGGACAATATCACCGTTGCGCTGGTATACGTT
721 GAATCTGAAGCCGTTTAA
Modified Oligotide sequence:
1 ATGGAGATTTCTCTCCTGACCGACATCGGTCAACGTCGTAGCAACAATCAAGAC 54
2 CAGTGGAACGCCCGCTTTGTTCTCAAACTGGTTGATGAAGTCTTGATTGTTGCTACGACG 60
3 AGCGGGCGTTCCACTGATCATCCTGGCGGACGGTATGGGTGGTCACCGTGCGGGTAATAT 60
4 CCCAGTCGCTACCCAGATCGGTAACGGTCATTTCAGACGCGATATTACCCGCACGGTGAC 60
5 ATCTGGGTAGCGACTGGGCGGAAACTGACTTCTCTGAACTGTCTGAGATCCGTGACTGGA 60
6 TCGTAGATTTTACGGTTTTCGGTTTCGATAGAAACCAGCATCCAGTCACGGATCTCAGAC 60
7 CCGAAAACCGTAAAATCTACGAACTGGGCCAGTCTGACGACTACAAAGGCATGGGTACCA 60
8 AAGATAATGTTGTCACCAACGATCGCAACCGCTTCGATGGTGGTACCCATGCCTTTGTAG 60
9 GATCGTTGGTGACAACATTATCTTCGCGCACGTAGGTGACTCTCGTATCGGTATCGTTCG 60
10 AGAGAGTGATCGCTGGTCAGCAGATGGTACTCACCTTGACGAACGATACCGATACGAGAG 60
11 TGACCAGCGATCACTCTCTGGTTAACGAACTCGTTAAGGCGGGTCAGCTCACGGAGGAGG 60
12 TAGACTGGGTGATGATGTTTTTCTGCGGGTGAGACGCCGCTTCCTCCTCCGTGAGCTGAC 60
13 GAAAAACATCATCACCCAGTCTATTGGTCAAGCGAATCCGGTTGAACCGGACCTGGGTGT 60
14 GTCAGAGTTAACAACCAGGTAGTCGCCTTCTTCCAGGAGATGTACACCCAGGTCCGGTTC 60
15 ACTACCTGGTTGTTAACTCTGACGGTCTGACCAACATGCTGTCTAACGCGGACATCGCGA 60
16 TCCTGGTTTTTGTCGTCCAGGGTTTTTTCCTGCGTCAGAACGGTCGCGATGTCCGCGTTA 60
17 CTGGACGACAAAAACCAGGATCTGATCACCCTGGCGAACCACCGTGGCGGCCTGGACAAT 60
18 TTAAACGGCTTCAGATTCAACGTATACCAGCGCAACGGTGATATTGTCCAGGCCGCCA 58
NanoDrop (09/02/13)
In this lab a spectrometer was used to identify the concentration and absorption of protein pGBR-22.
Figure 1. Run 1 Elution Graph, wavelength (nm) vs. absorbance (mm), results of pGBR22 protein (156.8 ng/ul) with a concentration of 165.4 ng/uL.
Figure 2. Run 2 Elution Graph, wavelength (nm) vs. absorbance (mm), results of pGBR22 protein (156.8 ng/ul) with a concentration of 150.5.
Conclusion: The use of the nano drop spectrometer allowed for the purity of the pGBR22 protein sample to be determined based on the absorbance and concentration results. Run 1 indicated a concentration of 165.5 ng/uL, while run 2 indicated a concentration of 150.5 ng/uL. These concentrations were slightly different, this is most likely a result of extra pGBR22, nano drop or buffer residue.
Submit to DNA Sequencing (09/02/13)
PCR & Run on Agarose Gel (09/02/13-09/05/13)
The purpose of this experiment was to test samples of different plasmid dilutions.
Figure 1. Agarose Gel of alternative dilutions of pGBR22 samples. Lane 1 contains 5 ul of Ladder solution, Lane 2-4 represent different dilutions of plasmid sample, Lane 5 represents a controlled sample with zero plasmid.
Conclusion: The results of the aragose gel are poor and only lane one is slightly visible. The errors of the gel results could be because of the smear obstructing the view of the solutions, contamination from unknown particles, or lack of keeping the samples cool between experimental steps.
DNA Analysis (09/05/13)
.>Untitled reverse complementTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTATTTAGGTGACACTATAGAATACTCAAGCTATGCATCCAACGCGTTGGGAGCTCTCCCATATGGTCGACCTGCAGGCGGCCGCACTAGTGATTTTGATTGATTGAAGGAGAAATATCATGAGTGTGATCGCTAAACAAATGACCTACAAGGTTTATATGTCAGGCACGGTCAATGGACACTACTTTGAGGTCGAAGGCGATGGAAAAGGAAAGCCTTACGAGGGGGAGCAGACGGTAAAGCTCACTGTCACCAAGGGTGGACCTCTGCCATTTGCTTGGGATATTTTATCACCACTGTCTCAATACGGAAGCATACCATTCACCAAGTACCCTGAAGACATCCCTGATTATGTAAAGCAGTCATTCCCTGAGGGATATACATGGGAGAGGATCATGAACTTTGAAGATGGTGCAGTGTGTACTGTCAGCAATGATTCCAGCATCCAAGGCAACTGTTTCATCTACAATGTCAAAATCTCTGGTGTGAACTTTCCTCCCAATGGACCTGTTATGCAGAAGAAGACACAGGGCTGGGAACCCAACACTGAGCGTCTCTTTGCACGAGATGGAATGCTGATAGGAAACAACTTTATGGCTCTGAAGTTGGAAGGAGGTGGTTACTATTTGTGTGAATTCAAATCTACTTACAAGGCAAAGAAGCCTGTGAGGATGCCAGGGTATCACTATGTTGACCGCAAACTGGATGTAACCAGTCACAACAAGGATTACACATTTGTTGAGCAGTGTGAAATATCCATTGCACGCCACTCTTTGCTCGGTCATCACCATCACCATCACTAAAATCCCGCGGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCC
The purpose of this experiment was to analyze a sequence of DNA from pGBR22 protein.
Week 2
PCR Primer Design Tails 09/13/13
Expression vector pNIC28-Bsa4, complete sequence:
TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGCACCATCATCATCATCATTCTTCTGGTGTAGATCTGGGTACCGAGAACCTGTACTTCCAATCCATGGAAATCTCTCTCCTGACTGACATCGGTCAACGTCGCTCTAATAACCAGGACTTCATCAATCAGTTCGAAAACAAGGCCGGTGTTCCGCTCATCATCCTGGCGGACGGCATGGGCGGTCACCGTGCGGGTAACATTGCGAGCGAAATGACCGTTACCGATCTGGGCTCTGACTGGGCGGAAACCGACTTCTCTGAACTGTCTGAAATCCGTGACTGGATGCTCGTTTCTATCGAAACGGAAAACCGTAAAATCTACGAACTGGGTCAGTCTGACGACTACATACTTCCAATCCTACTTCCAATCCAAGGTATGGGTACCACCATCGAAGCGGTTGCGATCGTTGGCGACAACATCATCTTCGCGCACGTTGGTGACTCTCGTATCGGTATCGTTCGTCAGGGTGAATACCATCTGCTGACTTCCGACCACTCTCTGGTTAACGAGCTGGTGAAAGCGGGTCAACTGACCGAAGAAGAAGCGGCGTCTCACCCGCAGAAGAATATCATCACCCAGTCTATTGGCCAGGCGAACCCGGTTGAACCGGACCTGGGCGTCCACCTGCTGGAAGAAGGTGACTACCTGGTTGTTAACTCTGACGGTCTGACCAACATGCTGTCTAACGCGGACATCGCGACCGTTCTGACGCAGGAAAAAACCCTGGACGACAAAAATCAGGACCTGATCACTCTCGCTAACCATCGTGGTGGTCTGGACAATATTACCGTTGCGCTGGTATACGTTGAATCTGAAGCTGTTTAACAGTAAAGGTGGATACGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATTGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAATTAATTCTTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGTTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCTTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTAGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCTGCGGTAAAGCTCATCAGCGTGGTCGTGAAGCGATTCACAGATGTCTGCCTGTTCATCCGCGTCCAGCTCGTTGAGTTTCTCCAGAAGCGTTAATGTCTGGCTTCTGATAAAGCGGGCCATGTTAAGGGCGGTTTTTTCCTGTTTGGTCACTGATGCCTCCGTGTAAGGGGGATTTCTGTTCATGGGGGTAATGATACCGATGAAACGAGAGAGGATGCTCACGATACGGGTTACTGATGATGAACATGCCCGGTTACTGGAACGTTGTGAGGGTAAACAACTGGCGGTATGGATGCGGCGGGACCAGAGAAAAATCACTCAGGGTCAATGCCAGCGCTTCGTTAATACAGATGTAGGTGTTCCACAGGGTAGCCAGCAGCATCCTGCGATGCAGATCCGGAACATAATGGTGCAGGGCGCTGACTTCCGCGTTTCCAGACTTTACGAAACACGGAAACCGAAGACCATTCATGTTGTTGCTCAGGTCGCAGACGTTTTGCAGCAGCAGTCGCTTCACGTTCGCTCGCGTATCGGTGATTCATTCTGCTAACCAGTAAGGCAACCCCGCCAGCCTAGCCGGGTCCTCAACGACAGGAGCACGATCATGCGCACCCGTGGGGCCGCCATGCCGGCGATAATGGCCTGCTTCTCGCCGAAACGTTTGGTGGCGGGACCAGTGACGAAGGCTTGAGCGAGGGCGTGCAAGATTCCGAATACCGCAAGCGACAGGCCGATCATCGTCGCGCTCCAGCGAAAGCGGTCCTCGCCGAAAATGACCCAGAGCGCTGCCGGCACCTGTCCTACGAGTTGCATGATAAAGAAGACAGTCATAAGTGCGGCGACGATAGTCATGCCCCGCGCCCACCGGAAGGAGCTGACTGGGTTGAAGGCTCTCAAGGGCATCGGTCGAGATCCCGGTGCCTAATGAGTGAGCTAACTTACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCCAGGGTGGTTTTTCTTTTCACCAGTGAGACGGGCAACAGCTGATTGCCCTTCACCGCCTGGCCCTGAGAGAGTTGCAGCAAGCGGTCCACGCTGGTTTGCCCCAGCAGGCGAAAATCCTGTTTGATGGTGGTTAACGGCGGGATATAACATGAGCTGTCTTCGGTATCGTCGTATCCCACTACCGAGATATCCGCACCAACGCGCAGCCCGGACTCGGTAATGGCGCGCATTGCGCCCAGCGCCATCTGATCGTTGGCAACCAGCATCGCAGTGGGAACGATGCCCTCATTCAGCATTTGCATGGTTTGTTGAAAACCGGACATGGCACTCCAGTCGCCTTCCCGTTCCGCTATCGGCTGAATTTGATTGCGAGTGAGATATTTATGCCAGCCAGCCAGACGCAGACGCGCCGAGACAGAACTTAATGGGCCCGCTAACAGCGCGATTTGCTGGTGACCCAATGCGACCAGATGCTCCACGCCCAGTCGCGTACCGTCTTCATGGGAGAAAATAATACTGTTGATGGGTGTCTGGTCAGAGACATCAAGAAATAACGCCGGAACATTAGTGCAGGCAGCTTCCACAGCAATGGCATCCTGGTCATCCAGCGGATAGTTAATGATCAGCCCACTGACGCGTTGCGCGAGAAGATTGTGCACCGCCGCTTTACAGGCTTCGACGCCGCTTCGTTCTACCATCGACACCACCACGCTGGCACCCAGTTGATCGGCGCGAGATTTAATCGCCGCGACAATTTGCGACGGCGCGTGCAGGGCCAGACTGGAGGTGGCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTGTTGTGCCACGCGGTTGGGAATGTAATTCAGCTCCGCCATCGCCGCTTCCACTTTTTCCCGCGTTTTCGCAGAAACGTGGCTGGCCTGGTTCACCACGCGGGAAACGGTCTGATAAGAGACACCGGCATACTCTGCGACATCGTATAACGTTACTGGTTTCACATTCACCACCCTGAATTGACTCTCTTCCGGGCGCTATCATGCCATACCGCGAAAGGTTTTGCGCCATTCGATGGTGTCCGGGATCTCGACGCTCTCCCTTATGCGACTCCTGCATTAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGCCGCCGCAAGGAATGGTGCATGCAAGGAGATGGCGCCCAACAGTCCCCCGGCCACGGGGCCTGCCACCATACCCACGCCGAAACAAGCGCTCATGAGCCCGAAGTGGCGAGCCCGATCTTCCCCATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCACCTGTGGCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCGAGATCTCGATCCCGCGAAAT